Sketch a diagram that illustrates how you will be decomposing & structuring your code for the DNA project.  Make sure to include:

• Descriptive Name and possibly explanation for each method so its function is clearly understood.
• Arrows showing how each method is being called by main along with the key parameters passed to the method and the data returned (if any) from it.
• Do your best to include any data structures key to your project design in the diagram.

This diagram will allow you to organize your thoughts on how to approach this project and make sure that you follow our Project Correctness Checklist to ensure a good score on its internal correctness.  It is a draft and does not need to reflect your final design.  This diagram can be simply drawn out on a sheet of paper or done using a graphics program – whatever is easiest for you.

Brief description of what you’ll do

Your goal will be to write a program which reads in an input file containing named sequences of nucleotides and can produce information about each of them. Specifically, for each nucleotide sequence, you will:

• count the occurrences of each of the four nucleotides (A, C, G, T)
• calculate the mass percentage occupied by each nucleotide type, rounded to one digit past the decimal point
• report the codons (trios of nucleotides) present in each sequence
• predict whether or not the sequence encodes a protein using a series of heuristics

For our purposes, a sequence encodes a protein if it meets the following constraints:

• begins with a valid start codon (ATG)
• ends with a valid stop codon (TAA, TAG, or TGA)
• contains at least 4 codons, including its start and stop codons
• at least 30% of its mass is Cytosine and Guanine

To compute mass percentages, use the following as the mass of each nucleotide:

• Adenine (A): 135.128
• Cytosine (C): 111.103
• Guanine (G): 151.128
• Thymine (T): 125.107

Note that these are approximations designed for this assignment and not exact constraints used in computational biology!

Requirements

For this assignment you should have at least four class constants to make your program more readable:

• minimum number of codons a valid protein must have, as an integer (default of 4)
• percentage of mass from C and G in order for a protein to be valid, as an integer (default of 30)
• number of unique nucleotides (4, representing A, C, G, and T)
• number of nucleotides per codon (3)

You must eliminate redundancy as much as possible throughout the program. Specifically, you should use the following arrays:

• nucleotide counts
• mass percentages
• codons

You should use methods in this program to provide structure and avoid redundancy. For full credit on this program, you must have four non-trivial methods other than main. You should decide for yourself exactly what methods to use, but for full credit, your methods should obey constraints such as (but not necessarily limited to) the following:

• No one method should be overly long.
• Each significant array in your program should be filled with data in its own individual method.
• Looking solely at main should present a clear idea of all of the major tasks your program is doing.
• Your methods should accept arrays as parameters or return arrays as their result values as appropriate.
• ALL OUTPUT MUST BE CREATED IN A SINGLE OUTPUT METHOD THAT TAKES ALL THE COMPUTED DATA AS PARAMETERS!!

You should follow past stylistic guidelines about indentation, whitespace, identifiers, and localizing variables. You should place comments at the beginning of your program, at the start of each method, and on complex sections of code.

A sample run

Assume you have a data file named dna.txt with the following content:

cure for cancer protein
ATGCCACTATGGTAG
captain picard hair growth protein
ATgCCAACATGgATGCCcGATAtGGATTgA
bogus protein
CCATtAATgATCaCAGTt

The user should be prompted in the following way for input and output files (user input underlined):

This program reports information about DNA nucleotide sequences that may encode proteins.

Input file name? dna.txt
Output file name? output.txt

You should then produce the following output in the file output.txt:

Name: cure for cancer protein
Nucleotides: ATGCCACTATGGTAG
Nucleotide counts: [4, 3, 4, 4]
Mass percentages: [27.3, 16.8, 30.6, 25.3]
Codons: [ATG, CCA, CTA, TGG, TAG]
Encodes a protein: yes

Name: captain picard hair growth protein
Nucleotides: ATGCCAACATGGATGCCCGATATGGATTGA
Nucleotide counts: [9, 6, 8, 7]
Mass percentages: [30.7, 16.8, 30.5, 22.1]
Codons: [ATG, CCA, ACA, TGG, ATG, CCC, GAT, ATG, GAT, TGA]
Encodes a protein: yes

Name: bogus protein
Nucleotides: CCATTAATGATCACAGTT
Nucleotide counts: [6, 4, 2, 6]
Mass percentages: [35.1, 19.3, 13.1, 32.5]
Codons: [CCA, TTA, ATG, ATC, ACA, GTT]
Encodes a protein: no

Download dna.txt with its corresponding output. Also try ecoli.txt with output here. Use quickdiff to compare your output.

Implementation hints

• Start by dealing with file input
• Read each protein’s name and sequence of nucleotides and print them
• Count As, Cs, Gs and Ts and put counts in an array of size 4 (can use charAt)
• Convert counts into mass percentages
• Revisit String methods to break sequence into codons and examine codons

Some biology

Deoxyribonucleic acid (DNA) is a complex biochemical macromolecule that carries genetic information for cellular life forms and some viruses. DNA consists of long chains of chemical compounds called nucleotides. Four nucleotides are present in DNA: Adenine (A), Cytosine (C), Guanine (G), and Thymine (T). DNA has a double-helix structure containing complementary chains of these four nucleotides connected by hydrogen bonds.

Certain portions of the DNA contain nucleotide sequences called genes, most of which encode instructions for building proteins. These proteins are responsible for carrying out most of the life processes of the organism. DNA is also the mechanism through which genetic information from parents is passed on during reproduction.

The nucleotides in a gene are organized into groups of three, called codons. Codons are typically written as the first letters of their three nucleotides, such as TAC or GGA. Each codon uniquely encodes a single amino acid, which is a building block of proteins.

The process of building proteins from DNA has two major phases called transcription and translation, in which a gene is replicated into an intermediate form called mRNA, which is then processed by a structure called a ribosome to build the chain of amino acids encoded by the codons of the gene.

The ranges of DNA that encode proteins occur between a start codon (which we will assume to be ATG) and a stop codon (which is any of TAA, TAG, or TGA). Not all regions of DNA contain protein-encoding genes; large portions that do not lie between a valid start and stop codon are called intergenic DNA and have other (possibly unknown) function.

Computational biologists examine large DNA data files to find patterns and important information, such as which regions encode particular proteins. They are also sometimes interested in the percentages of mass accounted for by each of the four nucleotide types. Often a high percentage of Cytosine (C) and Guanine (G) are found in regions of the DNA that contain important genetic data.

Project graciously borrowed from UW 142 and Ms. Martin’s previous AP CS Class.

Microsoft has announced its summer 2012 internship program for high school students.

“Here at Microsoft, high school students just like you will work on cutting-edge technology that will make a real difference in people’s lives all over the world. As an intern, your insider’s look into high-tech professions may give you a little inspiration as you make plans for college. It’ll also give you a head start on building a good resume. You’ll receive a competitive hourly wage plus a bus pass and software discounts. Sure beats scooping ice cream.”

It’s a great opportunity for current junior or senior students. You work on actual projects and get paid, not just hang around and do busy work.

More info can be found here: Microsoft Summer Internship. You’ll need a resume, transcripts, and a recommendation from one of your teachers.  And make sure to let Mr Bergquist know that you are applying.  The deadline to apply is March 12, 2012, so don’t wait until the last minute!

STEM Out!

It is free and will be held on Saturday, February 18th from 9:30 am — 2:30 pm, at UW’s Paul Allen Center for Computer, led by Amazon Hoppers (Women’s Group at Amazon.com).  Complete information & registration can be found here:  pscsta.org/p/stem-out.html

Sign up today!  (Please let Mr. Bergquist know if you will be attending, thanks!)

Final Careers Assignment in 3 Parts, the Introduction:

We have explored a wide variety of areas of computer science and there are many more for you to discover and investigate.  We are going to do a quick review of the computing areas & concepts covered and then you will reflect on the areas you could use in the future and those you are interested in investigating.  The goal is for you to identify what next areas of study including computer science that you should pursue to help you better reach your full potential, developing pathways to reach your current career goals.

By now it should be obvious that using computers in one form or another are key to you being productive for the rest of your life.  You already use them as a Consumer to communicate with friends and for entertainment.  You use a word processor to complete a homework paper and will likely be a User of computer applications in the workplace as part of your future job to be more effective.  And like the projects you created in Scratch, you may even become a Developer of new applications of computers to innovate solutions in a future career.

Recall we have looked at the three Roles you play in using computers as a Consumer, User & Developer

• Consumer – pays to enjoy (consume): Playing games, socializing, sharing videos, shopping, finding news & scores online.
• User – uses computers & applications in their job: Creates documents, enters data and runs reports, designs promotional material & websites.
• Developer – develops solutions with computers: creating new applications, using computers to solve research problems, connecting users.

And here is the list of some of the areas we have explored in class:

• Computer hardware and the parts of a computer
• How data is represented in a computer – for numbers, text and images
• Using an online application to created posters (Glogster)
• The Internet and World Wide Web – how it works and can be used
• Online safety & security – choosing a good password and keeping our personal data safe
• Internet Search and Browser options
• Designing web pages and a simple website – using HTML & CSS
• Creating projects in Scratch and the basic principles of computer programming

Over the week, you will create a single Word file in our class period’s shared Writeable Folder that will contain all three parts of this Final Assignment.  It is to be named “Final Careers – <your name>.docx” and saved to our shared writeable Exploring CS Folder for your class period.  The final Assignment’s three parts will count as your Final Exam, with Parts counting for 20 Project points as well as 20 Quiz points toward your final grade.

The three Parts of this Final Assignment are provided here:

• Part 1: Connecting with Computer Science – Warm up & Review (at least half a page)
• Part 2: Your Career Aspirations (at least 1 page)
• Part 3: Computing in the Workplace (at least 1 page)

All this work is due by end of day (5pm) Friday, January 27^th – the Final Exam Day for Exploring CS (periods 1 & 3).  If you miss any class day or the final (excused or not), you will need to make arrangements with Mr. Bergquist to get this completed for your final grade in a timely manner.

Part 3: Computing in the Workplace (at least 1 page)

Assignment: create an MS Word document that expresses your current career focus and develop with your responses to the following questions.  The goal is for you to be able to discover more about computing by investigating more deeply a way computing is used in your current career path or a specific computing career. The resulting paper should be at least 1 page long, written in full sentences, include specific examples, and contain as many details as you can find.  Do not just cut and paste text – I want this in your words and ideas about the subject.  Add your work to the Word file you started previously in our class period’s shared Writeable Folder, named “Final Careers – <your name>.docx” adding this work as the Part 3 section clearly.  Choose one of these two options for your paper:

Option 1: Your Career and Computing

Look up how computing affects a field you think you might be interested in pursuing.  For example, if you are interested in pursuing nursing, it would be very useful for you to know that Nursing Information Specialists are in high demand.  If you’re interested in being a journalist, you might investigate the role of social networking in providing news.  If you’re interested in becoming an FBI agent, read about how agency records are now linked by an expensive computer system.  If you want to be an auto mechanic, you might be interested in reading one mechanic saying that “computers have become as much a part of the tool box as wrenches.” Summarize the applications of computing you find and describe how they will impact what you do.  Provide lots of details and cite your sources.

Option 2: Cool Computing Jobs and Projects

Take this as an opportunity to dig more deeply into what it’s like to work in computing.  You could describe the daily tasks involved in a particular computing job, for example, a computer forensics expert.  Alternately, you could focus on a specific research area like Human Computer Interaction or a particular research project like Fold-It.  Provide lots of details and cite your sources.  These resources should help get you started:

• Computer science jobs
• Computing jobs
• Computer science sub-fields
• UW computer science research
• MIT media lab research

Part 2: Your Career Aspirations (at least 1 page)

Assignment: create an MS Word document that expresses your current career focus and develop your career page using the specific questions below.  The goal is for you to identify what next areas of study including computer science that you should pursue to help you better reach your full potential, developing pathways to reach your current career goals. The resulting paper should be at least 1 page long, written in full sentences, include specific examples, and contain as many detail as you can find.  Add your work to the Word file you started previously in our class period’s shared Writeable Folder, named “Final Careers – <your name>.docx” adding this work as the Part 2 section clearly.

1. What are some of the things you will look for in a career and why? (Money? Travel? Flexibility?)
2. If you had to pick a career path today, what would it be?  Why?
3. Research what kind of training that career path requires — is college the best way to reach your goals?  Describe at least two paths to get where you want to go.  Mention specific schools or programs you are interested in.
4. Describe all the ways in which you imagine you will use computing in this future path.

Local Resources:

Our Garfield Career & Technical Education (Vocational Education) Classes:

Computer Science

• Exploring Computer Science
• Introduction to CS: Creative Computing
• Advanced Placement Computer Science (APCS)
• Projects in CS

Business

• Business Computer Applications
• Web Page Design
• Accounting
• Business Law
• AP Macroeconomics
• Marketing 1-4 & Lab

Photography & Theatre

• Photography 1-4
• Technical Theatre

Seattle Skills Center (new for Fall 2012):

• AEROSPACE SCIENCE and TECHNOLOGY @King County International Airport
  Launch your aerospace career here (PDF)
• CISCO/MICROSOFT IT ACADEMY @Rainier Beach High School
  Enter the world of IT with Information Communications Technology (PDF)
• DIGITAL ANIMATION & GAME PROGRAMMING @Academy of Interactive Entertainment – Seattle Center
  Create games and animation! (PDF)
• MEDICAL CAREERS @West Seattle High School
  Establish your medical skills (PDF)

Part 1: Connecting with Computer Science

Assignment: The goal is to have you identify key areas of computer science that are most significant to you.  When we started the class we all took “How Techy are We?” survey where you answered the question “What is Computer Science?” and wrote down everything you knew about it.  Take a look at your answers from the beginning of the semester and reflect on what you have discovered and leaned, focusing on how this knowledge may help you in your future.  Then create an MS Word document responding to the following two questions, answering in full sentences and including examples and details, your answer should be at least half a page in length.  Save the Word file to our class period’s shared Writeable Folder, naming it “Final Careers – <your name>.docx”.

1. What did you find the most exciting in exploring computer science?  What areas and applications of computer science do you find the most interesting and will likely investigate further because of your own interests?  List at least two computer areas you enjoy.
2. What areas and applications of computer science do you feel will be the most useful to you, especially in future careers that you are considering. List two or more computer uses that will be important to your future, include specific examples of how you see yourself using them.

Create a “Release” of an appropriate version of one of your team’s projects to be available for review and copy of code to hopefully shared with your mentor and other students.  Produce the Release document or presentation in whatever format your team chooses (i.e. document, PowerPoint, video, etc.) that clearly includes:

• A Description of your Project’s overall goal
• What Features are included in this release?
• Clear instructions on how to install and use this version of the project
• Any limitations of this release (i.e. known bugs)
• Additional Features that your team would like to include in a future release
• What are the plans for this project after the semester’s end?

(Release will be evaluated for all these items)

Due Date: Since these Release Documents/Presentations are to be reviewed for feedback by the four mentors for grading, they are due by Friday, 17^th Feb – I will quickly review them in class and final version is needed no later than Monday, 20^th Feb.

1. NumberArrays (PI: Self-Check 7.4)
2. An Array Mystery (PI: Self-Check 7.23)
3. All Less (PI: Self-Check 7.13)
4. Deck of Cards: Consider the two following arrays:
   String[] suit = {"Clubs", "Diamonds", "Hearts", "Spades"};
String[] rank = {"2", "3", "4", "5", "6", "7", "8", "9", "10", "Jack", "Queen", "King", "Ace"}; Write a method that returns an array containing all possible playing cards as strings in the format “rank of suits” (use nested loops).
5. Shuffle Cards: Write a method shuffle that given an array of Strings (use the array from the previous problem), randomly orders it.  Do you have to return the array?  Can you use the swap method in the presentation?  Use the Math.random static method.  Shuffle your deck of cards and print it out using Arrays.toString

Done Already?  Then try these interesting challenges:

1. The birthday problem is a fascinating probability puzzle with implications in cryptography.  To investigate this problem, you will write a simulation to see on average how many people have to enter a room before two share a birthday.  Assume birthdays are represented by an integer between 0 and 364, each with an even probability.  Look at the die-rolling example done in class for ideas.  You will need a counter array of size 365.
2. Write a method that given an integer n returns an array of all primes up to and including n.  You will use a technique called the Sieve of Eratosthenes.  You will use a boolean array isPrime of size n where isPrime[i] is true if i is prime and false otherwise.  Initially, set all array elements to true.  Then repeat the following steps as long as i <= n/i:
   • Find the next smallest i where isPrime[i] is true
   • For all multiples of i, set the isPrime entries to false

   Once this is complete, the array should have a true for each prime and false for each non-prime. Collect the primes into an array (how many passes over the array does this take?)

   Compare this strategy to a more naive strategy that counts the factors for each number up to n.  What is the speed difference like?